Quantcast


CURATOR
A pinboard by
Aimon hasan

Im from the Institute of pharmaceutical sciences, Jinnah sindh medical University, Pakistan. And im the student of pharmacy.

Im higly devoted person towards my studies and researches the more I learn the more I become content

PINBOARD SUMMARY

Adulteration is a common problem nowadays in Pakistan and people are unaware of the fact.

People of Pakistan are lacking common knowledge. The crude drugs which they are using in their daily life is mostly adulterated and can produce toxic effects. As a pharmacist its my duty to spread the awareness regarding safety parameters for crude drug use. Pakistan is the 6th populated country in the world and during my survey in the most populated city of Pakistan, karachi, mostly people dont even know that adulteration can be done in many ways. Most of the people don't know that crude drugs has its appropriate dosage and time conditions and need proper consultation. According to survey 40% of the people dont know about the adulteration. 60% of the people know about adulteration but dont know about the safety parameters of using genuine crude drugs as it need proper consultation, dosage and time intervals. My achievement is to spread awareness among people by organising seminars with the help of funds collected by faculty members and these seminars will be free for all. That how can we identify sophistication, deterioration, elimination of the crude drugs and how to avoid using these ungenuine products.

7 ITEMS PINNED

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.

Abstract: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India.To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools.Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0.Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Pub.: 04 May '10, Pinned: 21 Sep '17

SCAR markers for correct identification of Phyllanthus amarus, P. fraternus, P. debilis and P. urinaria used in scientific investigations and dry leaf bulk herb trade.

Abstract: The trade in Phyllanthus material as bulk herb is rampant and mainly involves herbaceous species such as Phyllanthus amarus, P. fraternus, P . debilis and P. urinaria. These species are very important in herbal medicines and have varied activities. In India these species grow sympatrically and there are chances of deliberate or ignorant adulteration of crude drugs, lowering the efficiency of the medication for its intended purpose. Secondly, incorrect identification may also lead to erroneous reports on activities/molecules. To overcome this problem in crude drug (dry leaf powder) and compliment morphological identification in live plant, we have developed SCAR markers for all four species. In each species, we selected one fragment as being monomorphic between accessions but differing in size between species. These species-specific fragments were selected, cloned and sequenced. Based on the sequences, primer pairs were designed and amplification conditions standardized. SCAR markers were isolated from population DNA amplification profiles and validated by sequencing. The species-specific SCAR primers could retrieve the same size and sequence of fragments as in the RAPD profile. These fragments are 1150 bp, 317 bp, 980 bp and 550 bp in size for P. amarus, P. fraternus, P. debilis and P. urinaria, respectively. Additional fragments in P. debilis and P. urinaria indicate different alleles. The retrieval of same size and sequence of species-specific unique SCAR markers from the respective accessions (mixed DNA sample of same accessions) indicates the usefulness to study natural hybridization between the species in addition to adulteration.

Pub.: 27 Feb '08, Pinned: 21 Sep '17

Authentication of Schisandra chinensis and Schisandra sphenanthera in Chinese patent medicines.

Abstract: Authentication of species is crucial for ensuring the safety and efficacy of herbal medicines. The fruits of Schisandra chinensis and S. sphenanthera have been used for the same traditional Chinese drug, Wuweizi, but are found to be quite different according to their constituents, pharmacological effects, and qualities. These two fruits have been recorded as Schisandrae Chinensis Fructus (Wuweizi) and Schisandrae Sphenantherae Fructus (Nan-wuweizi), respectively, by Chinese Pharmacopoeia, 2000 edition. However, Nan-wuweizi is often found to be taken as Wuweizi in some Chinese patent drugs intentionally or by mistake because of its lower price and similar characteristics to Wuweizi. In this study, the selection and validation of special chemical markers for the identification of Schisandra species were established by HPLC-DAD-MS profiling analysis. Simple TLC and HPLC methods were proposed for the accurate determination of Nan-wuweizi from Wuweizi in Chinese patent medicines, using schisandrin and anwulignan as the identifying markers for Wuweizi and Nan-wuweizi, respectively. Through the establishment of a statistical model, adulterated or misused ratios of Nan-wuweizi in Wuweizi (w/w), as well as in Fenghan Kesou pills, can be determined. The limit of detection of Nan-wuweizi in a mixture (w/w) using both TLC and HPLC methods is 5% (mixed crude drugs of 50mg and 5g in a 1000g prescribed amount). The constructed statistical model relating the HPLC peak area ratio (anwulignan/schisandrin) and adulteration ratio is suitable for mixed crude drugs and Fenghan Kesou pills, and the two fitting equations have a good correlation (r=0.9979). Furthermore, 36 commercial Chinese patent medicines containing Wuweizi or Nan-wuweizi according to their labels were checked by these methods, and Nan-wuweizi was detected in Renshen Wuweizi Granules and Fenghan Kesou Pills. The ratios of Nan-wuweizi in these mixtures (w/w) were 100:0 for both, which does not comply with the statutory prescription. This study provided a simple and reliable method to prevent the adulteration or misuse of Nan-wuweizi in crude drugs and patent medicines of Wuweizi.

Pub.: 10 Sep '16, Pinned: 21 Sep '17

Effectiveness and safety of standardised shorter regimens for multidrug-resistant tuberculosis: individual patient data and aggregate data meta-analyses.

Abstract: We assessed the effectiveness and safety of standardised, shorter multidrug-resistant tuberculosis (MDR-TB) regimens by pooling data from observational studies.Published studies were identified from medical databases; unpublished studies were identified from expert consultation. We conducted aggregate data meta-analyses to estimate pooled proportions of treatment outcomes and individual patient data (IPD) meta-regression to identify risk factors for unsuccessful treatment in patients treated with 9- to 12-month MDR-TB regimens composed of a second-line injectable, gatifloxacin/moxifloxacin, prothionamide, clofazimine, isoniazid, pyrazinamide and ethambutol.We included five studies in which 796 out of 1279 (62.2%) individuals with confirmed MDR-TB (98.4%) or rifampin-resistant TB (1.6%), and not previously exposed to second-line drugs, were eligible for shorter regimens. 669 out of 796 participants were successfully treated (83.0%, 95% CI 71.9-90.3%). In IPD meta-regression (three studies, n=497), failure/relapse was associated with fluoroquinolone resistance (crude OR 46, 95% CI 8-273), pyrazinamide resistance (OR 8, 95% CI 2-38) and no culture conversion by month 2 of treatment (OR 7, 95% CI 3-202). Two participants acquired extensive drug resistance. Four studies reported grade 3 or 4 adverse events in 55 out of 304 (18.1%) participants.Shorter regimens were effective in treating MDR-TB; however, there is uncertainty surrounding the generalisability of the high rate of treatment success to less selected populations, to programmatic settings and in the absence of drug susceptibility tests to key component drugs.

Pub.: 29 Jul '17, Pinned: 21 Sep '17